Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07674

HP ID(1) HP07674
Gene ID(2) 55226
Gene Symbol finder NAT10
Protein Name N-acetyltransferase 10
RefSeq NM_024662.1
Length of RefSeq (bp) 4002
Chromosome 11p13
Reference DDBJ accession
UniGene Hs.577281

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi68D07 pGCAP10 GGTGACCCGGACACCAGGCATACGCTAGGGGCAGTCAGCTGTGCCTTCTCTTTCGGAGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl