Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07661

HP ID(1) HP07661
Gene ID(2) 23030
Gene Symbol finder JMJD2B
Protein Name jumonji domain containing 2B
RefSeq NM_015015.1
Length of RefSeq (bp) 5595
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.654816

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi65D10 pGCAP10 GGGGCTCGGTCGCCAGCAACCGAGCGGGGCCCGGCCCGAGCGGGGCCTGGGGGTGCNACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl