Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07625

HP ID(1) HP07625
Gene ID(2) 80014
Gene Symbol finder WWC2
Protein Name WW, C2 and coiled-coil domain containing 2
RefSeq NM_024949.5
Length of RefSeq (bp) 8822
Chromosome 4q35.1
Reference DDBJ accession
UniGene Hs.333179

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi58B08 pGCAP10 GGGATCCGAGCCCAGACGGCGGCGGCTCCGGCAGCCTGGGCGCCGCGACCCTCGGCGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl