Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07624

HP ID(1) HP07624
Gene ID(2) 64743
Gene Symbol finder WDR13
Protein Name WD repeat domain 13?
RefSeq NM_017883.4
Length of RefSeq (bp) 2150
Chromosome Xp11.23
Reference DDBJ accession
UniGene Hs.521973

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi58B02 pGCAP10 GACCCGGGTGGGAGTTCGTGACATCTCCGGCGCGGAGGGACTCGATGTCTATGGCAATGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl