Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07621

HP ID(1) HP07621
Gene ID(2) 51177
Gene Symbol finder PLEKHO1
Protein Name pleckstrin homology domain containing, family O member 1
RefSeq NM_016274.4
Length of RefSeq (bp) 1627
Chromosome 1q21.2
Reference DDBJ accession
UniGene Hs.438824

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi57F11 pGCAP10 GGGGAGCGGCCGCGCTGGGCCGGGCGGGCGGGTGGCGGGGGTGCGCTCGGGGACCCGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl