Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07606

HP ID(1) HP07606
Gene ID(2) 7171
Gene Symbol finder TPM4
Protein Name tropomyosin 4
RefSeq NM_003290.2
Length of RefSeq (bp) 2645
Chromosome 19p13.1
Reference DDBJ accession
UniGene Hs.631618

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi55G06 pGCAP10 GCCCCGCGCAGGCAAAGGCTTGGGGGGCCGGGGCGCGGCTGTGCAGCTCTCGCCGGAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl