Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07601

HP ID(1) HP07601
Gene ID(2) 55274
Gene Symbol finder PHF10
Protein Name PHD finger protein 10
RefSeq NM_018288.2
Length of RefSeq (bp) 1549
Chromosome 6q27
Reference DDBJ accession
UniGene Hs.435933

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi55D05 pGCAP10 GGCCGAGTACAACGCCGGGCCGTGGGGAGCCAGGCGGCGGCGGGGCTGAGGCGGCCGCGG
RBdS132D21 pGCAP10 GGCCGGGCCGTGGGGAGCCAGGCGGCGGCGGGGCTGAGGCGGCCGCGGGGCTGAGGGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl