Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07590

HP ID(1) HP07590
Gene ID(2) 83666
Gene Symbol finder PARP9
Protein Name poly (ADP-ribose) polymerase family, member 9
RefSeq NM_031458.2
Length of RefSeq (bp) 3359
Chromosome 3q21
Reference DDBJ accession
UniGene Hs.518200

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi52E05 pGCAP10 GGAGAGCGGCCTGCCGGAAGTGGGCCACCATATCTGGAAACTACAGTCTATGCTTTGAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl