Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07584

HP ID(1) HP07584
Gene ID(2) 51768
Gene Symbol finder TM7SF3
Protein Name transmembrane 7 superfamily member 3
RefSeq NM_016551.2
Length of RefSeq (bp) 4346
Chromosome 12q11-q12
Reference DDBJ accession
UniGene Hs.438641

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi51G07 pGCAP10 GGAGTTCGGCGGGGCGCGCGCCGGCGGCTGCGGAGCTGGCAGGTGCGAAGCGTCTGCACC
ARi55B09 pGCAP10 GAGGTGCCGGAAGAGGAAACCTCTCGCTGGGGCTAGGAGTTCGGCGGGGCGCGCGCCGGC
RBdS105A09 pGCAP10 GGGGGCTAGGAGTTCGGCGGGGCGCGCGCCGGCGGCTGCGGAGCTGGCAGGTGCGAAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl