Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07574

HP ID(1) HP07574
Gene ID(2) 9697
Gene Symbol finder TRAM2
Protein Name translocation associated membrane protein 2
RefSeq NM_012288.3
Length of RefSeq (bp) 7065
Chromosome 6p12.2
Reference DDBJ accession
UniGene Hs.520182

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi50G08 pGCAP10 GGCGCTGGGCGGGCGAGCGGCTGTGGGAGAGCGGGCGGCGGGCCGGCGGGCGGACCGGGC
RBdS083L19 pGCAP10 GGAAGTTGTTCCGCGCTGGGCGGGCGAGCGGCTGTGGGAGAGCGGGCGGCGGGCCGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl