Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07571

HP ID(1) HP07571
Gene ID(2) 56672
Gene Symbol finder C11orf17
Protein Name chromosome 11 open reading frame 17
RefSeq NM_020642.3
Length of RefSeq (bp) 1308
Chromosome 11p15.3
Reference DDBJ accession
UniGene Hs.131180

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi50E08 pGCAP10 GGCGCATGCGCCTTGACGAGTGAGCCGGGGAGCCATGGACAACTGTTTGGCGGCCGCAGC
ARiS055L15 pGCAP10 GGCATGCGCCTTGACGAGTGAGCCGGGGAGCCATGGACAACTGTTTGGCGGCCGCAGCGC
ARiS122N21 pGCAP10 GGTTGCGCGCATGCGCCTTGACGAGTGAGCCGGGTGAGGGGGCTCCCTAAGTAGCGGAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl