Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07565

HP ID(1) HP07565
Gene ID(2) 55325
Gene Symbol finder UFSP2
Protein Name UFM1-specific peptidase 2
RefSeq NM_018359.1
Length of RefSeq (bp) 1559
Chromosome 4q35.1
Reference DDBJ accession
UniGene Hs.713548

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi48G03 pGCAP10 GGGTCCGCCCGGGCCCCGCCCCTGGGCCGTGCGGTGACGCCACTTCAGGGCCGGCCCGCG
RBdS051A03 pGCAP10 GGCCCGGGCCCCGCCCCTGGGCCGTGCGGTGACGCCACTTCAGGGCCGGCCCGCGGAACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl