Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07560

HP ID(1) HP07560
Gene ID(2) 138162
Gene Symbol finder C9orf116
Protein Name chromosome 9 open reading frame 116
RefSeq NM_144654.2
Length of RefSeq (bp) 685
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.414028

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi48A12 pGCAP10 GACGCGAGGGGTCAGGGCCCGGGGTCCTGGGCTTGAGAGTCTCGGGCGGGGAGTGGAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl