Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07556

HP ID(1) HP07556
Gene ID(2) 9519
Gene Symbol finder TBPL1
Protein Name TBP-like 1
RefSeq NM_004865.2
Length of RefSeq (bp) 1340
Chromosome 6q22.1-q22.3
Reference DDBJ accession
UniGene Hs.486507

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi47G03 pGCAP10 GGCACCCGGAACAACAAAGCAAGGAAGACGGAGTCCGAGCCTCGGGGGCTCCTAGCAACG
ARi58G03 pGCAP10 GCTCGCACCCGGAACAACAAAGCAAGGAAGACGGAGTCCGAGCCTCGGGGGCTCCTAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl