Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07542

HP ID(1) HP07542
Gene ID(2) 11162
Gene Symbol finder NUDT6
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 6
RefSeq NM_007083.3
Length of RefSeq (bp) 1195
Chromosome 4q26
Reference DDBJ accession
UniGene Hs.558459

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi45F08 pGCAP10 GGTGGAGATGCGGCAGCCGCTGAGCTGGGGCCGCTGGCGCGCGATGCTTGCCCGAACCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl