Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07539

HP ID(1) HP07539
Gene ID(2) 79954
Gene Symbol finder NOL10
Protein Name nucleolar protein 10
RefSeq NM_024894.2
Length of RefSeq (bp) 3495
Chromosome 2p25.1
Reference DDBJ accession
UniGene Hs.222494

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi45E03 pGCAP10 GAGTCGGCGCCAGCGGCCGCACGCCGCGGAGCAGGGGCTCGGAGGTCCCGGGATTACGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl