Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07533

HP ID(1) HP07533
Gene ID(2) 114879
Gene Symbol finder OSBPL5
Protein Name oxysterol binding protein-like 5
RefSeq NM_020896.3
Length of RefSeq (bp) 3904
Chromosome 11p15.4
Reference DDBJ accession
UniGene Hs.436166

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi44A06 pGCAP10 GCCCGCGCCGCCAGTGGAGCCCCCGCGCGCCCGGCCGGCCCGGAGCACCGAGCTCGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl