Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07530

HP ID(1) HP07530
Gene ID(2) 148534
Gene Symbol finder TMEM56
Protein Name transmembrane protein 56
RefSeq NM_152487.2
Length of RefSeq (bp) 6836
Chromosome 1p21.3
Reference DDBJ accession
UniGene Hs.483512

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi43F06 pGCAP10 GGGAGCGGGAGCCGGAGCCCGAGCGGCCGCGGCCCCTTTAAGGAGCAGCTCTGCGGTAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl