Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07497

HP ID(1) HP07497
Gene ID(2) 90407
Gene Symbol finder TMEM41A
Protein Name transmembrane protein 41A?
RefSeq NM_080652.3
Length of RefSeq (bp) 2840
Chromosome 3q27.2
Reference DDBJ accession
UniGene Hs.715632

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS045L06 pGCAP10 GAGTCCGCCCGCCGCTGCGTCCCGGAGTGCAAGTGAGCTTCTCGGCTGCCCCGCGGGCCG
RBd74B09 pGCAP10 GGCTGCCCCGCGGGCCGGGGTGCGGAGCCGACATGCGCCCGCTTCTCGGCCTCCTTCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl