Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07485

HP ID(1) HP07485
Gene ID(2) 11108
Gene Symbol finder PRDM4
Protein Name PR domain containing 4
RefSeq NM_012406.3
Length of RefSeq (bp) 4225
Chromosome 12q23-q24.1
Reference DDBJ accession
UniGene Hs.506655

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023N14 pGCAP10 GGGAGGCCGCGGGCCGGGAAGGGCCGGGCGGGACGGGAAACGTTAGGGCAGCGGCCCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl