Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07467

HP ID(1) HP07467
Gene ID(2) 688
Gene Symbol finder KLF5
Protein Name Kruppel-like factor 5 (intestinal)
RefSeq NM_001730.3
Length of RefSeq (bp) 3350
Chromosome 13q22.1
Reference DDBJ accession
UniGene Hs.508234

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023F11 pGCAP10 GGCGGGGCAGGTACGTGCGCTCGCGGTTCTCTCGCGGAGGTCGGCGGTGGCGGGAGCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl