Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07462

HP ID(1) HP07462
Gene ID(2) 10826
Gene Symbol finder C5orf4
Protein Name chromosome 5 open reading frame 4
RefSeq NM_016348.1
Length of RefSeq (bp) 3051
Chromosome 5q31-q32
Reference DDBJ accession
UniGene Hs.519694

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023D13 pGCAP10 GACCCGAGCAAAAACAAGGTTAGCCTGCAGCAGAGCCGCAGCAGCAACAGCCACCAAAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl