Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07459

HP ID(1) HP07459
Gene ID(2) 55728
Gene Symbol finder N4BP2
Protein Name Nedd4 binding protein 2
RefSeq NM_018177.3
Length of RefSeq (bp) 6822
Chromosome 4p14
Reference DDBJ accession
UniGene Hs.391463

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023B20 pGCAP10 AB371584 GGCGCGGCGCGGGAGAGCGCAGTGGCGCCGGCGGGAAAGGGCTGCGGACCTGCGGCGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl