Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07450

HP ID(1) HP07450
Gene ID(2) 3604
Gene Symbol finder TNFRSF9
Protein Name tumor necrosis factor receptor superfamily, member 9
RefSeq NM_001561.4
Length of RefSeq (bp) 1935
Chromosome 1p36
Reference DDBJ accession
UniGene Hs.654459

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS020H15 pGCAP10 TAGAAGCCTGAAGACCAAGGAGTGGAAAGTTCTCCGGCAGCCCTGAGATCTCAAGAGTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl