Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07440

HP ID(1) HP07440
Gene ID(2) 80185
Gene Symbol finder C8orf41
Protein Name chromosome 8 open reading frame 41
RefSeq NM_025115.2
Length of RefSeq (bp) 2520
Chromosome 8p12
Reference DDBJ accession
UniGene Hs.77135

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109P19 pGCAP10 GGCGGCAGCAATATGAGCTAGGTCCGGATCCTGTTAGACACCGGCGGGCGCGAGCCGTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl