Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07420

HP ID(1) HP07420
Gene ID(2) 51131
Gene Symbol finder PHF11
Protein Name PHD finger protein 11
RefSeq NM_001040443.1
Length of RefSeq (bp) 1649
Chromosome 13q14.3
Reference DDBJ accession
UniGene Hs.369039

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109D19 pGCAP10 GAGGCGTCGCCGCCCCGGCCCGAGAGGGTGCTCGGCGCCAGCAGCCCGGAGGCCCGGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl