Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07419

HP ID(1) HP07419
Gene ID(2) 57587
Gene Symbol finder KIAA1430
Protein Name KIAA1430
RefSeq NM_020827.1
Length of RefSeq (bp) 4892
Chromosome 4q35.1
Reference DDBJ accession
UniGene Hs.535734

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109D12 pGCAP10 GGTTCAGGGCCGCGGGAGTGCGCCAGCGCCGCGCGTGGGGCTGTGGTGGCCGCGGCTCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl