Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07362

HP ID(1) HP07362
Gene ID(2) 93624
Gene Symbol finder TADA2B
Protein Name transcriptional adaptor 2 (ADA2 homolog, yeast)-beta
RefSeq NM_152293.2
Length of RefSeq (bp) 4312
Chromosome 4p16.1
Reference DDBJ accession
UniGene Hs.518614

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd27C04 pGCAP10 GGCCTGCGTACTGAGGGGGGACGCGGCCCGGCTGGCTGGCTCTGGCGGCGGCTGGGCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl