Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07360

HP ID(1) HP07360
Gene ID(2) 9088
Gene Symbol finder PKMYT1
Protein Name protein kinase, membrane associated tyrosine/threonine 1
RefSeq NM_004203.3
Length of RefSeq (bp) 2121
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.77783

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd26G08 pGCAP10 TAAGGCGTTCACGGGCCGTTCCCCCTCACGGGAGTCCTCCGCCCGGGCGTCCGGAACAGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl