Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07351

HP ID(1) HP07351
Gene ID(2) 148223
Gene Symbol finder C19orf25
Protein Name chromosome 19 open reading frame 25
RefSeq NM_152482.2
Length of RefSeq (bp) 2276
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.532840

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd25D11 pGCAP10 GGGGTCCCGCGCCCAGAGATGGGCTCCAAGGCAAAGAAGCGCGTGCTGCTGCCCACCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl