Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07341

HP ID(1) HP07341
Gene ID(2) 5494
Gene Symbol finder PPM1A
Protein Name protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform
RefSeq NM_021003.4
Length of RefSeq (bp) 8210
Chromosome 14q23.1
Reference DDBJ accession
UniGene Hs.130036

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd23H10 pGCAP10 GGCTCGTCCGGCCCGCAGCTTCGGGTCCTCAGGCGGCTGTTGCTCCGGAACGGGTGGTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl