Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07340

HP ID(1) HP07340
Gene ID(2) 8019
Gene Symbol finder BRD3
Protein Name bromodomain containing 3
RefSeq NM_007371.3
Length of RefSeq (bp) 5673
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.522472

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd23H08 pGCAP10 GAAAGAGGAGCCGGCCGCGCGGGCCGGGAGGGGACGGCCGCCGGAGCCGCGAGGCCAACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl