Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07339

HP ID(1) HP07339
Gene ID(2) 55212
Gene Symbol finder BBS7
Protein Name Bardet-Biedl syndrome 7
RefSeq NM_018190.2
Length of RefSeq (bp) 2606
Chromosome 4q27
Reference DDBJ accession
UniGene Hs.591694

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd23F12 pGCAP10 CGGCCGGCCGATGAGGGGCGCGGGCAGCCTTCTGACTGGGTCGGAGGCCTGCGGGCCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl