Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07318

HP ID(1) HP07318
Gene ID(2) 5817
Gene Symbol finder PVR
Protein Name poliovirus receptor
RefSeq NM_006505.3
Length of RefSeq (bp) 5904
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.171844

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013J11 pGCAP10 GGGGCCAGCCTGGGTGGCCCACCCCGCGCCTGGCGGGACTGGCCGCCAACTCCCCTCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl