Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07317

HP ID(1) HP07317
Gene ID(2) 23548
Gene Symbol finder TTC33
Protein Name tetratricopeptide repeat domain 33
RefSeq NM_012382.2
Length of RefSeq (bp) 5519
Chromosome 5p15.2-p12
Reference DDBJ accession
UniGene Hs.348915

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013J07 pGCAP10 GGAAGAGATTGGCGGAGGGGAAAGACTGAGTCGTCTTTCCTTTGCCCGCTTCTGTGGACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl