Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07313

HP ID(1) HP07313
Gene ID(2) 147184
Gene Symbol finder TMEM99
Protein Name transmembrane protein 99
RefSeq NM_145274.2
Length of RefSeq (bp) 2065
Chromosome 17q21.2
Reference DDBJ accession
UniGene Hs.353163

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013G12 pGCAP10 GGCCGAAACTTCCGCCGCCGCGTCCGCCGCCTCCGGAACTAAACGGGATGGAGCTAACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl