Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07312

HP ID(1) HP07312
Gene ID(2) 84897
Gene Symbol finder TBRG1
Protein Name transforming growth factor beta regulator 1
RefSeq NM_032811.2
Length of RefSeq (bp) 5162
Chromosome 11q24.2
Reference DDBJ accession
UniGene Hs.436410

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013G02 pGCAP10 GAGACACGGAAGTGCTGGGAGGCGCCGGGAGCCCGTTCGGTTGCGGGTGTCTCTGGCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl