Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07306

HP ID(1) HP07306
Gene ID(2) 54859
Gene Symbol finder C3orf75
Protein Name chromosome 3 open reading frame 75
RefSeq NM_001031703.2
Length of RefSeq (bp) 1374
Chromosome 3p21.31
Reference DDBJ accession
UniGene Hs.311100

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013D19 pGCAP10 GGCATGCGCGCTTCCTTGCGCGAGCCGGGCTGTCGGGTGTGTTTTGCTCTCCATCCTCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl