Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07278

HP ID(1) HP07278
Gene ID(2) 54958
Gene Symbol finder TMEM160
Protein Name transmembrane protein 160
RefSeq NM_017854.1
Length of RefSeq (bp) 696
Chromosome 19q13.32
Reference DDBJ accession
UniGene Hs.105606

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi54D06 pGCAP10 GGGGAGGCGGCTGGTGGTGGGCTCGAACCNCAANNACNCCACTCNTNNCATANCTCGTTT
ARiS008H06 pGCAP10 GGCGCGGCGGCCGTAGTGCGAATCATGGGAGGCGGCTGGTGGTGGGCTCGGGCCGCTCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl