Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07272

HP ID(1) HP07272
Gene ID(2) 373
Gene Symbol finder TRIM23
Protein Name tripartite motif-containing 23
RefSeq NM_001656.3
Length of RefSeq (bp) 3914
Chromosome 5q12.3
Reference DDBJ accession
UniGene Hs.792

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS008C04 pGCAP10 GGAGGACTCTGAAGGCTGTTTCTGTGGCGCTTCCCCTGCGAGGATGGCTACCCTGGTTGT
ARiS087C06 pGCAP10 GGTGGCGCTTCCCCTGCGAGGATGGCTACCCTGGTTGTAAACAAGCTCGGAGCGGGAGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl