Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07258

HP ID(1) HP07258
Gene ID(2) 9933
Gene Symbol finder KIAA0020
Protein Name KIAA0020
RefSeq NM_014878.4
Length of RefSeq (bp) 2232
Chromosome 9p24.2
Reference DDBJ accession
UniGene Hs.493309

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS015P01 pGCAP10 GATCCGCTGCGCGAGCTGTCTCGGTCCCACGTGTGCGAGTTGCTACGATGGAAGTTAAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl