Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07251

HP ID(1) HP07251
Gene ID(2) 51808
Gene Symbol finder PHAX
Protein Name phosphorylated adaptor for RNA export
RefSeq NM_032177.2
Length of RefSeq (bp) 1751
Chromosome 5q23.2
Reference DDBJ accession
UniGene Hs.693680

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd22D01 pGCAP10 GGTTGGAGGTCGGCGATATGGAAGATGGGCAGCTTTCCGACTCGGATTCCGACATGACGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl