Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07245

HP ID(1) HP07245
Gene ID(2) 84063
Gene Symbol finder KIRREL2
Protein Name kin of IRRE like 2 (Drosophila)
RefSeq NM_199180.2
Length of RefSeq (bp) 2993
Chromosome 19q13.12
Reference DDBJ accession
UniGene Hs.145729

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd21E09 pGCAP10 AB593116 GAGAGCGTCAGAGGCTGCGGATGAGCAGACTTGGAGGACTCCAGGCCAGAGACTAGGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl