Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07220

HP ID(1) HP07220
Gene ID(2) 5190
Gene Symbol finder PEX6
Protein Name peroxisomal biogenesis factor 6
RefSeq NM_000287.3
Length of RefSeq (bp) 3514
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.656425

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd18C09 pGCAP10 GCTCTCTGGCTCCGGAAGCTGCGCTCCTTCACCCTCCTCGTTGGTGTCCTGTCACCATGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl