Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07192

HP ID(1) HP07192
Gene ID(2) 3768
Gene Symbol finder KCNJ12?
Protein Name potassium inwardly-rectifying channel, subfamily J, member 12
RefSeq NM_021012.4
Length of RefSeq (bp) 5230
Chromosome 17p11.2
Reference DDBJ accession
UniGene Hs.200629

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd13G12 pGCAP10 GGTGCTCTCCGCGGAGAGTTAGAGGAGTTGCCGAGCTGAGCTCCGGTGGAGCGAGGCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl