Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07185

HP ID(1) HP07185
Gene ID(2) 65094
Gene Symbol finder JMJD4
Protein Name jumonji domain containing 4?
RefSeq NM_023007.1
Length of RefSeq (bp) 2550
Chromosome 1q42.13
Reference DDBJ accession
UniGene Hs.555974

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd13C09 pGCAP10 GGGACCGCGAGACGCGCGCCCTCGCCGACAGCCACTTCCGAGGCCTGGGGGTCGAGGTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl