Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07124

HP ID(1) HP07124
Gene ID(2) 10403
Gene Symbol finder NDC80
Protein Name NDC80 homolog, kinetochore complex component (S. cerevisiae)
RefSeq NM_006101.2
Length of RefSeq (bp) 2209
Chromosome 18p11.32
Reference DDBJ accession
UniGene Hs.414407

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi13E09 pGCAP10 GAGGAAGGACCTGGTGTTTTGATGACCGCTGTCCTGTCTAGCAGATACTTGCACGGTTTA
RBd46D09 pGCAP10 TGGGAGAATTTCANTTCGAACGGCTTTGGCGGGCCGAGGAAGGACCTGGTGTTTTGATGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl