Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07120

HP ID(1) HP07120
Gene ID(2) 5681
Gene Symbol finder PSKH1
Protein Name protein serine kinase H1
RefSeq NM_006742.2
Length of RefSeq (bp) 3505
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.513683

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb71H01 pGCAP1 GAACGCCCGAGAATGGCGGCGGCGGCGGCGGCGGCGGCGGCCGCTGCCATTGCCCGGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl