Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07080

HP ID(1) HP07080
Gene ID(2) 9816
Gene Symbol finder URB2
Protein Name URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
RefSeq NM_014777.2
Length of RefSeq (bp) 5613
Chromosome 1q42.13
Reference DDBJ accession
UniGene Hs.533628

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi20G07 pGCAP10 GACCCGTACAGCGGCCTCCGCCGCACCGGGACAGCAGCCGCCGCCGCTGCCGCCGTCCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl