Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06993

HP ID(1) HP06993
Gene ID(2) 6399
Gene Symbol finder TRAPPC2
Protein Name trafficking protein particle complex 2
RefSeq NM_014563.4
Length of RefSeq (bp) 2715
Chromosome Xp22
Reference DDBJ accession
UniGene Hs.592238

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi74E06 pGCAP10 GCTCTTCCGCGGAAACTGACATTGCGTTTCCGTTGTCGGCCTCCCACTGCAGGAGCCATA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl